Immunohistochemistry:Article Title: LINC01137 facilitate pancreatic cancer stemness via the miR-7155-5p/KLF12/AKT axis
Article Snippet: .. Species Dilution GAPDH Proteintech 60004-1-Ig Mouse 1:1000 p-AKT Cell Signaling Technology 4060 Rabbit 1:2000 CD44 Proteintech 60224-1-Ig Mouse 1:2000 Sox2 Cell Signaling Technology 3579 Rabbit 1:1000 Oct-4A Cell Signaling Technology 2840 Rabbit 1:1000 p-Rb Cell Signaling Technology 8516 Rabbit 1:1000 p21 Cell Signaling Technology 2947 Rabbit 1:1000 KLF12 Proteintech 13156-1-AP Rabbit 1:1000 ALDH1A1 Cell Signaling Technology 54135 Rabbit 1:1000 NANOG Cell Signaling Technology 4903 Rabbit 1:2000 Cyclin D3 Cell Signaling Technology 2936 Mouse 1:2000 CDK4 Cell Signaling Technology 12790 Rabbit 1:1000 AKT Cell Signaling Technology 4685 Rabbit 1:1000 Table 3 Primary antibodies for IHC Antibody Company Cat. No. .. Species Dilution CD133 Proteintech 18470-1-AP Rabbit 1:500 CD44 Proteintech 60224-1-Ig Mouse 1:500 PCNA Servicebio GB11010 Rabbit 1:500 Table 4 MiRNA mimics and inhibitor, shRNA, and NC sequences.
Article Title: LINC01137 involvement in pancreatic cancer stemness via the miR-7155-5p/KLF12/AKT axis
Article Snippet: .. Species Dilution GAPDH Proteintech 60004-1-Ig Mouse 1:1000 p-AKT Cell Signaling Technology 4060 Rabbit 1:2000 CD44 Proteintech 60224-1-Ig Mouse 1:2000 Sox2 Cell Signaling Technology 3579 Rabbit 1:1000 Oct-4A Cell Signaling Technology 2840 Rabbit 1:1000 p-Rb Cell Signaling Technology 8516 Rabbit 1:1000 p21 Cell Signaling Technology 2947 Rabbit 1:1000 KLF12 Proteintech 13156-1-AP Rabbit 1:1000 ALDH1A1 Cell Signaling Technology 54135 Rabbit 1:1000 NANOG Cell Signaling Technology 4903 Rabbit 1:2000 Cyclin D3 Cell Signaling Technology 2936 Mouse 1:2000 CDK4 Cell Signaling Technology 12790 Rabbit 1:1000 AKT Cell Signaling Technology 4685 Rabbit 1:1000 Table 3 Primary antibodies for IHC Antibody Company Cat. No. .. Species Dilution CD133 Proteintech 18470-1-AP Rabbit 1:500 CD44 Proteintech 60224-1-Ig Mouse 1:500 PCNA Servicebio GB11010 Rabbit 1:500 Page 19/30 Name Nucleotide sequence (5' to 3') hsa-miR-7155-5p inhibitor GAUGGCCCAAGACCCCAGA inhibitor NC UCUACUCUUUCUAGGAGGUUGUGA hsa-miR-7155-5p-mimics sense UCUGGGGUCUUGGGCCAUC hsa-miR-7155-5p-mimics antisense UGGCCCAAGACCCCAGAUU mimics NC sense UCACAACCUCCUAGAAAGAGUAGA mimics NC antisense UCUACUCUUUCUAGGAGGUUGUGA sh-LINC01137#1 sense GGGTGAGAACCTACTTCTTCA sh-LINC01137#1 antisense TGAAGAAGTAGGTTCTCACCC sh-LINC01137#2 sense GCATCATGCATGTAACTTTCA sh-LINC01137#2 antisense TGAAAGTTACATGCATGATGC sh-Control sense TTCTCCGAACGTGTCACGT sh-Control antisense ACGTGACACGTTCGGAGAA Figures Page 20/30 Figure 1 Higher LINC01137 expression in PCSCs was associated with poor outcome. a Heatmap showing the differential long intergenic lncRNAs between CSC-like and non-CSC-like cells whose data was obtained from GSE51971. b Relationship between LINC01137 and stemness-associated genes (CD44 and CD133) in TCGA and MTAB 6690. c Differential and d-e prognostic analyses of LINC01137 in the GEPIA database using data from TCGA. f The expression of LINC01137 in patients divided by cancer stages using Page 21/30 expression data from TCGA database (n=179). g LINC01137 expression in 72 pairs of PDAC tumor tissues and adjacent normal tissues. h Prognostic analysis of LINC01137 using clinical prognostic data of 72 patients from Ruijin Hospital, Shanghai. i LINC01137 expression in pancreatic cell lines. j Knockdown e ciency of LINC01137 in two pancreatic cell lines (CFPAC-1 and Panc-1).
Sequencing:Article Title: LINC01137 involvement in pancreatic cancer stemness via the miR-7155-5p/KLF12/AKT axis
Article Snippet: Species Dilution GAPDH Proteintech 60004-1-Ig Mouse 1:1000 p-AKT Cell Signaling Technology 4060 Rabbit 1:2000 CD44 Proteintech 60224-1-Ig Mouse 1:2000 Sox2 Cell Signaling Technology 3579 Rabbit 1:1000 Oct-4A Cell Signaling Technology 2840 Rabbit 1:1000 p-Rb Cell Signaling Technology 8516 Rabbit 1:1000 p21 Cell Signaling Technology 2947 Rabbit 1:1000 KLF12 Proteintech 13156-1-AP Rabbit 1:1000 ALDH1A1 Cell Signaling Technology 54135 Rabbit 1:1000 NANOG Cell Signaling Technology 4903 Rabbit 1:2000 Cyclin D3 Cell Signaling Technology 2936 Mouse 1:2000 CDK4 Cell Signaling Technology 12790 Rabbit 1:1000 AKT Cell Signaling Technology 4685 Rabbit 1:1000 Table 3 Primary antibodies for IHC Antibody Company Cat. No. .. Species Dilution CD133 Proteintech 18470-1-AP Rabbit 1:500 CD44 Proteintech 60224-1-Ig Mouse 1:500 PCNA Servicebio GB11010 Rabbit 1:500 Page 19/30 Name Nucleotide sequence (5' to 3') hsa-miR-7155-5p inhibitor GAUGGCCCAAGACCCCAGA inhibitor NC UCUACUCUUUCUAGGAGGUUGUGA hsa-miR-7155-5p-mimics sense UCUGGGGUCUUGGGCCAUC hsa-miR-7155-5p-mimics antisense UGGCCCAAGACCCCAGAUU mimics NC sense UCACAACCUCCUAGAAAGAGUAGA mimics NC antisense UCUACUCUUUCUAGGAGGUUGUGA sh-LINC01137#1 sense GGGTGAGAACCTACTTCTTCA sh-LINC01137#1 antisense TGAAGAAGTAGGTTCTCACCC sh-LINC01137#2 sense GCATCATGCATGTAACTTTCA sh-LINC01137#2 antisense TGAAAGTTACATGCATGATGC sh-Control sense TTCTCCGAACGTGTCACGT sh-Control antisense ACGTGACACGTTCGGAGAA Figures Page 20/30 Figure 1 Higher LINC01137 expression in PCSCs was associated with poor outcome. a Heatmap showing the differential long intergenic lncRNAs between CSC-like and non-CSC-like cells whose data was obtained from GSE51971. b Relationship between LINC01137 and stemness-associated genes (CD44 and CD133) in TCGA and MTAB 6690. c Differential and d-e prognostic analyses of LINC01137 in the GEPIA database using data from TCGA. f The expression of LINC01137 in patients divided by cancer stages using Page 21/30 expression data from TCGA database (n=179). g LINC01137 expression in 72 pairs of PDAC tumor tissues and adjacent normal tissues. h Prognostic analysis of LINC01137 using clinical prognostic data of 72 patients from Ruijin Hospital, Shanghai. i LINC01137 expression in pancreatic cell lines. j Knockdown e ciency of LINC01137 in two pancreatic cell lines (CFPAC-1 and Panc-1). ..
Expressing:Article Title: LINC01137 involvement in pancreatic cancer stemness via the miR-7155-5p/KLF12/AKT axis
Article Snippet: Species Dilution GAPDH Proteintech 60004-1-Ig Mouse 1:1000 p-AKT Cell Signaling Technology 4060 Rabbit 1:2000 CD44 Proteintech 60224-1-Ig Mouse 1:2000 Sox2 Cell Signaling Technology 3579 Rabbit 1:1000 Oct-4A Cell Signaling Technology 2840 Rabbit 1:1000 p-Rb Cell Signaling Technology 8516 Rabbit 1:1000 p21 Cell Signaling Technology 2947 Rabbit 1:1000 KLF12 Proteintech 13156-1-AP Rabbit 1:1000 ALDH1A1 Cell Signaling Technology 54135 Rabbit 1:1000 NANOG Cell Signaling Technology 4903 Rabbit 1:2000 Cyclin D3 Cell Signaling Technology 2936 Mouse 1:2000 CDK4 Cell Signaling Technology 12790 Rabbit 1:1000 AKT Cell Signaling Technology 4685 Rabbit 1:1000 Table 3 Primary antibodies for IHC Antibody Company Cat. No. .. Species Dilution CD133 Proteintech 18470-1-AP Rabbit 1:500 CD44 Proteintech 60224-1-Ig Mouse 1:500 PCNA Servicebio GB11010 Rabbit 1:500 Page 19/30 Name Nucleotide sequence (5' to 3') hsa-miR-7155-5p inhibitor GAUGGCCCAAGACCCCAGA inhibitor NC UCUACUCUUUCUAGGAGGUUGUGA hsa-miR-7155-5p-mimics sense UCUGGGGUCUUGGGCCAUC hsa-miR-7155-5p-mimics antisense UGGCCCAAGACCCCAGAUU mimics NC sense UCACAACCUCCUAGAAAGAGUAGA mimics NC antisense UCUACUCUUUCUAGGAGGUUGUGA sh-LINC01137#1 sense GGGTGAGAACCTACTTCTTCA sh-LINC01137#1 antisense TGAAGAAGTAGGTTCTCACCC sh-LINC01137#2 sense GCATCATGCATGTAACTTTCA sh-LINC01137#2 antisense TGAAAGTTACATGCATGATGC sh-Control sense TTCTCCGAACGTGTCACGT sh-Control antisense ACGTGACACGTTCGGAGAA Figures Page 20/30 Figure 1 Higher LINC01137 expression in PCSCs was associated with poor outcome. a Heatmap showing the differential long intergenic lncRNAs between CSC-like and non-CSC-like cells whose data was obtained from GSE51971. b Relationship between LINC01137 and stemness-associated genes (CD44 and CD133) in TCGA and MTAB 6690. c Differential and d-e prognostic analyses of LINC01137 in the GEPIA database using data from TCGA. f The expression of LINC01137 in patients divided by cancer stages using Page 21/30 expression data from TCGA database (n=179). g LINC01137 expression in 72 pairs of PDAC tumor tissues and adjacent normal tissues. h Prognostic analysis of LINC01137 using clinical prognostic data of 72 patients from Ruijin Hospital, Shanghai. i LINC01137 expression in pancreatic cell lines. j Knockdown e ciency of LINC01137 in two pancreatic cell lines (CFPAC-1 and Panc-1). ..
Knockdown:Article Title: LINC01137 involvement in pancreatic cancer stemness via the miR-7155-5p/KLF12/AKT axis
Article Snippet: Species Dilution GAPDH Proteintech 60004-1-Ig Mouse 1:1000 p-AKT Cell Signaling Technology 4060 Rabbit 1:2000 CD44 Proteintech 60224-1-Ig Mouse 1:2000 Sox2 Cell Signaling Technology 3579 Rabbit 1:1000 Oct-4A Cell Signaling Technology 2840 Rabbit 1:1000 p-Rb Cell Signaling Technology 8516 Rabbit 1:1000 p21 Cell Signaling Technology 2947 Rabbit 1:1000 KLF12 Proteintech 13156-1-AP Rabbit 1:1000 ALDH1A1 Cell Signaling Technology 54135 Rabbit 1:1000 NANOG Cell Signaling Technology 4903 Rabbit 1:2000 Cyclin D3 Cell Signaling Technology 2936 Mouse 1:2000 CDK4 Cell Signaling Technology 12790 Rabbit 1:1000 AKT Cell Signaling Technology 4685 Rabbit 1:1000 Table 3 Primary antibodies for IHC Antibody Company Cat. No. .. Species Dilution CD133 Proteintech 18470-1-AP Rabbit 1:500 CD44 Proteintech 60224-1-Ig Mouse 1:500 PCNA Servicebio GB11010 Rabbit 1:500 Page 19/30 Name Nucleotide sequence (5' to 3') hsa-miR-7155-5p inhibitor GAUGGCCCAAGACCCCAGA inhibitor NC UCUACUCUUUCUAGGAGGUUGUGA hsa-miR-7155-5p-mimics sense UCUGGGGUCUUGGGCCAUC hsa-miR-7155-5p-mimics antisense UGGCCCAAGACCCCAGAUU mimics NC sense UCACAACCUCCUAGAAAGAGUAGA mimics NC antisense UCUACUCUUUCUAGGAGGUUGUGA sh-LINC01137#1 sense GGGTGAGAACCTACTTCTTCA sh-LINC01137#1 antisense TGAAGAAGTAGGTTCTCACCC sh-LINC01137#2 sense GCATCATGCATGTAACTTTCA sh-LINC01137#2 antisense TGAAAGTTACATGCATGATGC sh-Control sense TTCTCCGAACGTGTCACGT sh-Control antisense ACGTGACACGTTCGGAGAA Figures Page 20/30 Figure 1 Higher LINC01137 expression in PCSCs was associated with poor outcome. a Heatmap showing the differential long intergenic lncRNAs between CSC-like and non-CSC-like cells whose data was obtained from GSE51971. b Relationship between LINC01137 and stemness-associated genes (CD44 and CD133) in TCGA and MTAB 6690. c Differential and d-e prognostic analyses of LINC01137 in the GEPIA database using data from TCGA. f The expression of LINC01137 in patients divided by cancer stages using Page 21/30 expression data from TCGA database (n=179). g LINC01137 expression in 72 pairs of PDAC tumor tissues and adjacent normal tissues. h Prognostic analysis of LINC01137 using clinical prognostic data of 72 patients from Ruijin Hospital, Shanghai. i LINC01137 expression in pancreatic cell lines. j Knockdown e ciency of LINC01137 in two pancreatic cell lines (CFPAC-1 and Panc-1). ..
shRNA:
Article Title: LINC01137 facilitate pancreatic cancer stemness via the miR-7155-5p/KLF12/AKT axis
Article Snippet: Species Dilution GAPDH Proteintech 60004-1-Ig Mouse 1:1000 p-AKT Cell Signaling Technology 4060 Rabbit 1:2000 CD44 Proteintech 60224-1-Ig Mouse 1:2000 Sox2 Cell Signaling Technology 3579 Rabbit 1:1000 Oct-4A Cell Signaling Technology 2840 Rabbit 1:1000 p-Rb Cell Signaling Technology 8516 Rabbit 1:1000 p21 Cell Signaling Technology 2947 Rabbit 1:1000 KLF12 Proteintech 13156-1-AP Rabbit 1:1000 ALDH1A1 Cell Signaling Technology 54135 Rabbit 1:1000 NANOG Cell Signaling Technology 4903 Rabbit 1:2000 Cyclin D3 Cell Signaling Technology 2936 Mouse 1:2000 CDK4 Cell Signaling Technology 12790 Rabbit 1:1000 AKT Cell Signaling Technology 4685 Rabbit 1:1000 Table 3 Primary antibodies for IHC Antibody Company Cat. No. .. Species Dilution CD133 Proteintech 18470-1-AP Rabbit 1:500 CD44 Proteintech 60224-1-Ig Mouse 1:500 PCNA Servicebio GB11010 Rabbit 1:500 Table 4 MiRNA mimics and inhibitor, shRNA, and NC sequences. ..
|
Proteintech is a verified supplier 